View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14228_low_6 (Length: 385)
Name: NF14228_low_6
Description: NF14228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14228_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 1e-69; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 230 - 371
Target Start/End: Original strand, 43962906 - 43963047
Alignment:
| Q |
230 |
ttataaaatggaaagcgaaattaagtaaacaacatttcaaaacaaaatattttcaagaagtttcttgtgttcaaatgcttttaaccttttacctatcata |
329 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43962906 |
ttataaaaaggaaagcgaaattaagtaaacaacatttcaaaacaaaatattttcaagaagtttcttttgttcaaatgcttttaaccttttacctatcata |
43963005 |
T |
 |
| Q |
330 |
aggtgcatgattcactaggttctaacaactctaacatcttat |
371 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43963006 |
aggtgcatgattcactaggttctaacaactctaacatcttat |
43963047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University