View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14229_high_10 (Length: 495)
Name: NF14229_high_10
Description: NF14229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14229_high_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 146; Significance: 1e-76; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 1e-76
Query Start/End: Original strand, 47 - 225
Target Start/End: Complemental strand, 21787786 - 21787608
Alignment:
| Q |
47 |
gatgtgactaactatatttagaccgggttcatatatgccatannnnnnnagaggtaattcttttcaggtagaaaaaattatagcaatgacttgaaataaa |
146 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21787786 |
gatgtgactaactatttttagaccgggttcatatatgccatatttttttagaggtaattcttttcaggtagaaaaaattatagcaatgacttgaaataaa |
21787687 |
T |
|
| Q |
147 |
gtcttttgacattgatgatgattaattttgctcttttaattcatttatatgcacagcaactttgtttccactcctcatg |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
21787686 |
gtcttttgacattgatgatgattaattttgcacttttaattcattgatatgcacagcaactttgtttccactcctcatg |
21787608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 411 - 478
Target Start/End: Complemental strand, 21782932 - 21782865
Alignment:
| Q |
411 |
tgtgttcaacctcacgttgccgctgttaaataatctgaactgttggatagtggtttgatggctcatgt |
478 |
Q |
| |
|
|||||||||||||||||||||| || || |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
21782932 |
tgtgttcaacctcacgttgccgtcgtcaagtaatctgaactgttggatagtggtctgatggctcatgt |
21782865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 201 - 280
Target Start/End: Complemental strand, 21794412 - 21794332
Alignment:
| Q |
201 |
agcaactttgtttccactcctcatgtcaatta-ggtttttcaaatagtcaacagaattctctggattggaatgcttgtttc |
280 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||| ||||| ||| ||| ||||||||||| ||||| ||||| ||||||| |
|
|
| T |
21794412 |
agcaacgttgtttcaactcctcatgtcaattagggtttcgcaagaagttaacagaattctttggataggaattattgtttc |
21794332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University