View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14229_high_25 (Length: 333)
Name: NF14229_high_25
Description: NF14229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14229_high_25 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 1e-69; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 156 - 305
Target Start/End: Original strand, 2626802 - 2626951
Alignment:
| Q |
156 |
cacaattaacattccaattaaaaactagggacgacaattatcaatgcaacgagagacatagagattgagtgataaaaacatcataaattaaacttgtgtc |
255 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2626802 |
cacaattaacattctaattaaaaactagggaggacaattatcaatgcaacgagagacatagagattgagtgataaaaatatcataaattaaacttgtgtc |
2626901 |
T |
|
| Q |
256 |
actgattagtttcaaaaatatattgactggtatagataggttagtattta |
305 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2626902 |
actgattagtttcagaaatatattgactggtatagataggttagtattta |
2626951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 2626646 - 2626681
Alignment:
| Q |
1 |
ttaagaggcccaaatctcttaccatttgaccaatcc |
36 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2626646 |
ttaagaggcccaaatctcttaccacttgaccaatcc |
2626681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University