View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14229_high_29 (Length: 305)
Name: NF14229_high_29
Description: NF14229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14229_high_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 113; Significance: 3e-57; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 17 - 199
Target Start/End: Original strand, 12808427 - 12808604
Alignment:
| Q |
17 |
ggaccaactaaattttcataaattcagctattgnnnnnnnntatgatgattaatcttacccttttgcgaagctcttccatttgttcaaccataatttgtg |
116 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12808427 |
ggaccaaacaaattttcataaattcagctattgaaaaaaa--atgatgattaatcttacccttttgcgaagctcttccatttgttcaatcataatttgtg |
12808524 |
T |
 |
| Q |
117 |
tctgcaattgaaataaaaattcagctatgatcatccgtaatcaatgttttatatacattcacaaccaatattgttctaaattg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
12808525 |
tctgcaattgaaataaaaattcagctatgatcatcccaaatcaaggttttatatacattcacaacc---attgttctaaattg |
12808604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 85 - 123
Target Start/End: Complemental strand, 28475301 - 28475263
Alignment:
| Q |
85 |
aagctcttccatttgttcaaccataatttgtgtctgcaa |
123 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
28475301 |
aagctcttccatttgttcaaccataatctgtgtctgcaa |
28475263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University