View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14229_high_31 (Length: 295)
Name: NF14229_high_31
Description: NF14229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14229_high_31 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 1 - 285
Target Start/End: Original strand, 3542239 - 3542523
Alignment:
| Q |
1 |
ttgcttgacactgaagctcaggagattgaatttgagattgcaagaatgagaccacggtttgtagtacttttcagatgaatgggattcatctctatattct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
3542239 |
ttgcttgacactgaagctcaggagattgaatttgagattgcaagaatgagaccacggtttgtagtacttttcaaatgaatgggattcacctctatattct |
3542338 |
T |
|
| Q |
101 |
gttgtgttgagtctgtttttatatcaatgcaccgtgactcttaagttctgcagattaaacgacgaattcattttggcactaaaatccgagttaggacagc |
200 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3542339 |
gttgtgctgagtctatttttatatcaatgcaccgtgactcttaagttctgcagattaaacgacgaattcattttggcactaaaatccgagttaggacagc |
3542438 |
T |
|
| Q |
201 |
ttcgatttgctgttaacaaaacacaggtttcggactctttttggtggttattttcattgaataaattattctagtctctgctcct |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3542439 |
ttcgatttgctgttaacaaaacacaggtttcggactctttttggtggttattttcattgaataaattattctagtctctggtcct |
3542523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University