View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14229_high_40 (Length: 238)
Name: NF14229_high_40
Description: NF14229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14229_high_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 5 - 224
Target Start/End: Original strand, 51310344 - 51310563
Alignment:
| Q |
5 |
gaacatctgatgaaacctctgtcgtaatgtaaaccctgcaactgcttcttgcaacgttggcatgtttaacaagcgttgaagatgacatggtcgaaggttt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51310344 |
gaacatctgatgaaacctctgtcgtaatgtaaaccctgcaactgcttcttgcaacgttggcatgtttaacaagcgttgaagatgacatggtcgaaggttt |
51310443 |
T |
 |
| Q |
105 |
tttctacggacacaagcgtcgttttgtgaaacgcctaatactcgaatcataacgaagaggatgtgtttgcatggtattgtccggtccgggcacgtgcacg |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
51310444 |
tttctacggacacaagcgtcgttttgtgaaacgcctaatactcgaatcataacgaagaggatgtgtttgcatggtgttgtccggtccgggcacgtgcacg |
51310543 |
T |
 |
| Q |
205 |
agggtgtggaagataaggtt |
224 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
51310544 |
agggtgtggaagataaggtt |
51310563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University