View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14229_low_33 (Length: 312)
Name: NF14229_low_33
Description: NF14229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14229_low_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 15 - 300
Target Start/End: Complemental strand, 44623025 - 44622722
Alignment:
| Q |
15 |
attatacttacttttgcaggctgtcgccacaggcaatctgtacctctcnnnnnnngtccttatgctctggagcttatgtggaggcttctgttaactctaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
44623025 |
attatacttacttttgcaggctgtcgccacaggcaatctgtacctctcaaaaaaagtccttatgctctggagctcatgtggaggcttctgttaactctaa |
44622926 |
T |
 |
| Q |
115 |
tcctgtgaaaaattacatagcagctagtttttcttcactgcgatctgaagcaaaacccctggtttccaaacaatcactcaaaaagcgcatgttttcagtt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44622925 |
tcctgtgaaaaattacatagcagctagtttttcttcactgcgatctgaagcaaaacccctggtttccaaacaatcactcaaaaagcgcatgttttcagtg |
44622826 |
T |
 |
| Q |
215 |
ggagctttagtagctcgaacagatcaggatgtttct------------------gatgataagattggagtgttattgctaaaccttggaggtccagaga |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44622825 |
ggagctttagtagctcgaacagatcaggatgtttctgatgcaactcttacatctgatgataagattggagtgttattgctaaaccttggaggtccagaga |
44622726 |
T |
 |
| Q |
297 |
ctct |
300 |
Q |
| |
|
|||| |
|
|
| T |
44622725 |
ctct |
44622722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 250 - 300
Target Start/End: Complemental strand, 39878051 - 39878001
Alignment:
| Q |
250 |
tgatgataagattggagtgttattgctaaaccttggaggtccagagactct |
300 |
Q |
| |
|
|||||| ||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39878051 |
tgatgacaagatcggagtgttattgttaaaccttggaggtccagagactct |
39878001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University