View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14229_low_40 (Length: 253)
Name: NF14229_low_40
Description: NF14229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14229_low_40 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 30 - 240
Target Start/End: Original strand, 463494 - 463708
Alignment:
| Q |
30 |
cgtgctttattatcagccgta----ggtttaccactaaaatgactaaacttcctcttttttattgagtcttctgtttagctttctgtacccaaactttca |
125 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
463494 |
cgtgctttattatcagccgtacgtaggtttaccactaaaatgactaaacttcctcttttttattgagtcttctgtttagctttctgtacccaaactttca |
463593 |
T |
 |
| Q |
126 |
tcatcgatagtcatctgatcatcttcctggtcattatcatcttcctcgtcatggtcggttaacaactcatccccaagaacatcagttgcaaaatcgactc |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
463594 |
tcatcgatagtcatctgatcatcttcctggtcattatcatcttcctcgtcatggtcggttaacaactcatccccaagaacatcagttgcaaaatcgactc |
463693 |
T |
 |
| Q |
226 |
cttcataggcctttg |
240 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
463694 |
cttcataggcctttg |
463708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University