View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14229_low_43 (Length: 245)
Name: NF14229_low_43
Description: NF14229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14229_low_43 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 16086043 - 16085822
Alignment:
| Q |
1 |
ataaggagaactcaaaacaattacaactatacttgaaacttaaaggtttaaaccaccgatgaataaccttacgaataggcaccagaaccatcctgcagag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16086043 |
ataaggagaactcaaaacaattacaactatacttgaaacttaaaggtttaaaccaccgatgaataaccttacgaataggcaccagaaccatcctgcagag |
16085944 |
T |
 |
| Q |
101 |
ctaacctca--ccctaaccaacatgtctcataataagcctactataagcaccaggtaaaaaacattttccgacgcaaaattaagcttttaacagaaatgt |
198 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16085943 |
ctaacctcaccccctaaccaacatgtctcataataagcctactataagcaccaggtaaaaaacattttccgacgcaaaattaagcttttaacagaaatgt |
16085844 |
T |
 |
| Q |
199 |
cattttgttcattaaccatata |
220 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
16085843 |
cattttgttcattaaccatata |
16085822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University