View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14229_low_47 (Length: 237)
Name: NF14229_low_47
Description: NF14229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14229_low_47 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 16086089 - 16086310
Alignment:
| Q |
1 |
tgaaaaaacaaattatatccagaaattgcatctcataagttgataatctagtaggtgaaaccatatataattgttacattctttctctctttttgcttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16086089 |
tgaaaaaacaaattatatccagaaattgcatctcataagttgataatctagtaggtgaaaccatatataattgttacattctttctctctttttgcttat |
16086188 |
T |
|
| Q |
101 |
tttatgctgtaatttgtagggatggataccagctttgaagaatgaattgttggctttcatgtcaagtctcaaatcttatcttgattttctaacttctaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16086189 |
tttatgctgtaatttgtagggatggataccagctttgaagaatgaattgttggctttcatgtcaagtctcaaatcttatcttgattttctaacttctaaa |
16086288 |
T |
|
| Q |
201 |
atcagtgaggtctctcgtgtat |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
16086289 |
atcagtgaggtctctcgtgtat |
16086310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 108 - 165
Target Start/End: Original strand, 16080799 - 16080856
Alignment:
| Q |
108 |
tgtaatttgtagggatggataccagctttgaagaatgaattgttggctttcatgtcaa |
165 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||| | ||||||| |||| |
|
|
| T |
16080799 |
tgtaatttgtaggagtggataccagctttgaagaatgaactgtggactttcatatcaa |
16080856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University