View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14229_low_49 (Length: 237)
Name: NF14229_low_49
Description: NF14229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14229_low_49 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 16 - 222
Target Start/End: Complemental strand, 4598008 - 4597802
Alignment:
| Q |
16 |
atttgttgtgcttcagtgtcaatgaaccagattggaacagtttgtataatgctatagacaatttagcctctcggaattcagttaaatagaaccatttaat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| ||||||| | |
|
|
| T |
4598008 |
atttgttgtgcttcagtgtcaatgaaccagattggaacagtttgtataatgctatatacaatttagcctctcagaattcagttaaatagagccatttatt |
4597909 |
T |
 |
| Q |
116 |
tggatatggagttaagcttgcatttcatgtcggaagcttttccttttttaatgaattttcatgttggagaaagaatcatgcaaggacaaacaaatgaaaa |
215 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4597908 |
tggatatggagttaagcttacatttcatgtcggaagcttttccttttttaatgaattttcatgttggagaaagaatcatgcaaggacaaacaaatgaaaa |
4597809 |
T |
 |
| Q |
216 |
ttgagag |
222 |
Q |
| |
|
||||||| |
|
|
| T |
4597808 |
ttgagag |
4597802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University