View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14229_low_50 (Length: 234)
Name: NF14229_low_50
Description: NF14229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14229_low_50 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 18 - 220
Target Start/End: Complemental strand, 45597814 - 45597607
Alignment:
| Q |
18 |
caatattgtgcccaaatatatttatttagacacaagtatatctctatgcgtaattgtttatttatattattgcatatagttagaaaaatttgatattt-- |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45597814 |
caatattgtgcccaaatatatttatttagacacaagtatatctctatgcgtaattgtttatttatattattgcatatagttagaaaaaattgatatttct |
45597715 |
T |
 |
| Q |
116 |
---agactaaatatcttattaatcgaaatgttttttgttaaattgaaaatgtgacagtttcgtaacctgcaaagctggacccgagagcttgttccacccc |
212 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
45597714 |
gttagactaaatgtcttattaatcgaaatgttttttgttaaattgaaaatgtgacagtttcgtaaccttcaaagctggacccgagagtttgttccacccc |
45597615 |
T |
 |
| Q |
213 |
attcatct |
220 |
Q |
| |
|
|||||||| |
|
|
| T |
45597614 |
attcatct |
45597607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 169 - 220
Target Start/End: Complemental strand, 42794449 - 42794398
Alignment:
| Q |
169 |
gtttcgtaacctgcaaagctggacccgagagcttgttccaccccattcatct |
220 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42794449 |
gtttcgtaacctgcaaagcttgacccgagagcttgttccaccccattcatct |
42794398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 169 - 220
Target Start/End: Complemental strand, 19398246 - 19398195
Alignment:
| Q |
169 |
gtttcgtaacctgcaaagctggacccgagagcttgttccaccccattcatct |
220 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
19398246 |
gtttcgtaacctgcaaagcttgacccgagagcttgttccaccccattcatct |
19398195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 168 - 218
Target Start/End: Complemental strand, 13510283 - 13510233
Alignment:
| Q |
168 |
agtttcgtaacctgcaaagctggacccgagagcttgttccaccccattcat |
218 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
13510283 |
agtttcgtaaccagcaaagcttgacccgagagcttgttccaccccattcat |
13510233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University