View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14229_low_52 (Length: 219)
Name: NF14229_low_52
Description: NF14229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14229_low_52 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 122; Significance: 9e-63; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 11 - 144
Target Start/End: Complemental strand, 6347214 - 6347081
Alignment:
| Q |
11 |
aagaatatgaatattttttaaaaaactccctagagtcgaatcgtgcaaccatgtgtccctcaccctatttatcaataccgcttaccactgctacaaaatc |
110 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6347214 |
aagaaaatgaatattttttaaaaaactccctagagtcgaatcgtgcaaccatgtgtccctcgcgctatttatcaataccgcttaccactgctacaaaatc |
6347115 |
T |
 |
| Q |
111 |
aagcttctagttgaacgctgaaaattgtcgtgat |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
6347114 |
aagcttctagttgaacgctgaaaattgtcgtgat |
6347081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 144 - 200
Target Start/End: Complemental strand, 6342729 - 6342673
Alignment:
| Q |
144 |
ttttgtagtaaaagtggaacactcaccgcgcaaatacgcataatttgattacaatgc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6342729 |
ttttgtagtaaaagtggaacactcaccgcgcaaatacgcataatttgattacaatgc |
6342673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 17 - 101
Target Start/End: Complemental strand, 37963117 - 37963033
Alignment:
| Q |
17 |
atgaatattttttaaaaaactccctagagtcgaatcgtgcaaccatgtgtccctcaccctatttatc-aataccgcttaccactgc |
101 |
Q |
| |
|
||||||||| ||| |||||||| ||||| ||||||||||||| |||||||||| | ||||||||| |||||| ||||||||||| |
|
|
| T |
37963117 |
atgaatattattttaaaaactct-tagaggcgaatcgtgcaacgatgtgtcccttgcgctatttatcaaatacctcttaccactgc |
37963033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University