View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14229_low_54 (Length: 204)
Name: NF14229_low_54
Description: NF14229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14229_low_54 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 2102594 - 2102409
Alignment:
| Q |
1 |
tggtaaattcggattatcttttaatgttatcattattcaattcattcagatacaatttaagtgataaagttataataaatgaagttaggttagtgcatac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| |||||| ||||||| ||||||| |
|
|
| T |
2102594 |
tggtaaattcggattatcttttaatgttatcattattcaattcattcagatgcaatttaagtgataa-gttataatacatgaagataggttaatgcatac |
2102496 |
T |
|
| Q |
101 |
acattaaggggaactaacctgcttgcagacaagctgagagtcacctcggacatgaacatgctcatatccttggttgctagcttctttc |
188 |
Q |
| |
|
||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2102495 |
acagtaaggg-aactaacctgcttgcagacaagctgagagtcacctcggacatgaacatgctcatatccttggttgctagcttctttc |
2102409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 68; Significance: 1e-30; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 109 - 184
Target Start/End: Original strand, 39183543 - 39183618
Alignment:
| Q |
109 |
gggaactaacctgcttgcagacaagctgagagtcacctcggacatgaacatgctcatatccttggttgctagcttc |
184 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
39183543 |
gggaactaacctgcttgcaaacaagctgagagtcacctcggacatgaacatgctcatatccttggttcctagcttc |
39183618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University