View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14229_low_56 (Length: 201)
Name: NF14229_low_56
Description: NF14229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14229_low_56 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 20 - 178
Target Start/End: Complemental strand, 45604497 - 45604333
Alignment:
| Q |
20 |
agagactcatcaaagcaccttaccaaaactattgtttgctgaatggctttcattggatcatgttaataata------ggaactcttcaaattcagttgaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45604497 |
agagactcatcaaagcaccttaccaaaactattgtttgctgaatggctttcattggatcatgttaataataataataggaactcttcaaattcagttgaa |
45604398 |
T |
 |
| Q |
114 |
tctttggtcatgagaaatggatttgatcaaaattcagcttttcaagaagttacaatgcaagaagg |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45604397 |
tctttggtcatgagaaatggatttgatcaaaattcagcttttcaagaagttacaatgcaagaagg |
45604333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 39 - 161
Target Start/End: Original strand, 20070142 - 20070264
Alignment:
| Q |
39 |
ttaccaaaactattgtttgctgaatggctttcattggatcatgttaataataggaactcttcaaattcagttgaatctttggtcatgagaaatggatttg |
138 |
Q |
| |
|
||||||||||| || ||| |||| ||||||||| | ||||| || ||| | | |||||| |||||||| ||| ||||||||| ||| |||||| | || |
|
|
| T |
20070142 |
ttaccaaaacttttattttctgagtggctttcactagatcaagtaaatggttgcaactctctaaattcagatgattctttggtcttgaaaaatggctatg |
20070241 |
T |
 |
| Q |
139 |
atcaaaattcagcttttcaagaa |
161 |
Q |
| |
|
||||||||| | |||||||||| |
|
|
| T |
20070242 |
atcaaaatttaatttttcaagaa |
20070264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University