View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1422R-Insertion-13 (Length: 224)
Name: NF1422R-Insertion-13
Description: NF1422R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1422R-Insertion-13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 102; Significance: 8e-51; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 46 - 206
Target Start/End: Complemental strand, 43228526 - 43228375
Alignment:
| Q |
46 |
ttggtatccataccattctctcataggctttcttgttgttgtcaccgtcttttttgatgtaactttctttttcgccnnnnnnnnnnnnngcttagcaaga |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43228526 |
ttggtatccataccattctctcataggctttcttgttgttgtcaccatcttttttgatgtaactttctttttcgcc----------atagcttagcaaga |
43228437 |
T |
|
| Q |
146 |
atcaaatcctctgcag-ccagagagtgtgattgaaggaaatggttatgctcaactgcttctt |
206 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43228436 |
atcaaatcctctgcagcccggagagtgtgattgaaggaaatggttatgctcaactgcttctt |
43228375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 137 - 196
Target Start/End: Complemental strand, 43238852 - 43238793
Alignment:
| Q |
137 |
ttagcaagaatcaaatcctctgcagccagagagtgtgattgaaggaaatggttatgctca |
196 |
Q |
| |
|
|||||||||||||||| || || || | |||||||||||||| ||||||||||||||||| |
|
|
| T |
43238852 |
ttagcaagaatcaaatgctatgtagtcggagagtgtgattgagggaaatggttatgctca |
43238793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University