View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1422R-Insertion-17 (Length: 176)
Name: NF1422R-Insertion-17
Description: NF1422R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1422R-Insertion-17 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 4e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 4e-86
Query Start/End: Original strand, 8 - 176
Target Start/End: Complemental strand, 51548169 - 51548001
Alignment:
| Q |
8 |
aaaactactgctgcatttccaaatatgtaatctatggtcccaaaaatatcacactctctatagaattgtctaaatgagtgaacataaagtgtgtcttggt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51548169 |
aaaactactgctgcatttccaaatatgtaatctatggtcccaaaaatgtcacactctctatagaattgtctaaatgagtgaacataaagtgtgtcttggt |
51548070 |
T |
|
| Q |
108 |
aaccatacattgcacatttgtaaaaagctgttacgtctgcattcactcttaatgcaactgcttgatgct |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
51548069 |
aaccatacattgcacatttgtaaaaagctgttacgtctgcgttcactcttaatgcaactgcttgatgct |
51548001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 80; Significance: 8e-38; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 80; E-Value: 8e-38
Query Start/End: Original strand, 11 - 174
Target Start/End: Complemental strand, 19476599 - 19476436
Alignment:
| Q |
11 |
actactgctgcatttccaaatatgtaatctatggtcccaaaaatatcacactctctatagaattgtctaaatgagtgaacataaagtgtgtcttggtaac |
110 |
Q |
| |
|
|||||||| || || ||||||||| ||||||| ||||| |||| || || || | ||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
19476599 |
actactgcggcgttaccaaatatgaaatctattgtcccgtaaatgtcgcattcgcggtagaattgtctgaatgagtggacataaagtgtgtcttggtaac |
19476500 |
T |
|
| Q |
111 |
catacattgcacatttgtaaaaagctgttacgtctgcattcactcttaatgcaactgcttgatg |
174 |
Q |
| |
|
|||| ||||| ||||||||||| ||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
19476499 |
cataaattgcgcatttgtaaaatgctgttaaatctgcatttactcttaatgcaactgcttgatg |
19476436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University