View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1422_high_14 (Length: 364)

Name: NF1422_high_14
Description: NF1422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1422_high_14
NF1422_high_14
[»] chr8 (2 HSPs)
chr8 (10-200)||(39524322-39524512)
chr8 (233-356)||(39525679-39525800)
[»] chr7 (1 HSPs)
chr7 (309-356)||(41215713-41215761)


Alignment Details
Target: chr8 (Bit Score: 179; Significance: 2e-96; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 10 - 200
Target Start/End: Original strand, 39524322 - 39524512
Alignment:
10 gcagagacgccatttttagggttttaggagaaggaacgtgaagaaggttggaagggatggtaacaatcgttacaaaggggttttagttttggaatagact 109  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||    
39524322 gcagagacgccatttttagggttttaggagaaggaacgtgaagaaggttggaagggatgggaacaatcgttacaaaggagttttagttttggaatagact 39524421  T
110 tgcctacagtaccatacacacagttcttactgttcccctatcacagcaacaagccacgtgtattaaaattctctctcttgcgtaggtttaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
39524422 tgcctacagtaccatacacacagttcttactgttcccctatcacaacaacaagccacgtgtattaaaattctctctcttgcgtaggtttaa 39524512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 233 - 356
Target Start/End: Original strand, 39525679 - 39525800
Alignment:
233 ggttaaaccgttataaaacctacgagaatcaaataaaattgaaaaatctatgagaaatcgggaaatgaaaagctaggagaatggttgtttacgggagttt 332  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||| |||||||||||||||||||||||||||||||||||    
39525679 ggttaaaccgttataaaacctacgagaatcaaataaaattgaaaaatct--gagaaatcgggaagtgaaaagctaggagaatggttgtttacgggagttt 39525776  T
333 tggaggatcgatgtttgtgatgat 356  Q
    |||||||| |||||||||||||||    
39525777 tggaggattgatgtttgtgatgat 39525800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 309 - 356
Target Start/End: Original strand, 41215713 - 41215761
Alignment:
309 gagaatggttgtttacgggagttttggagga-tcgatgtttgtgatgat 356  Q
    ||||||||||| ||||||||||||||||||| | |||||||||||||||    
41215713 gagaatggttgcttacgggagttttggaggatttgatgtttgtgatgat 41215761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University