View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1422_high_16 (Length: 347)
Name: NF1422_high_16
Description: NF1422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1422_high_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 10 - 331
Target Start/End: Complemental strand, 531448 - 531127
Alignment:
| Q |
10 |
aaggtgaatatgcctcaatgctaagcttggttggaaacaaaacatttgtgaaattgtaacccgaatgagggttactaccaccaaccaaaaccctcccatc |
109 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
531448 |
aaggtgaatatgcttcaatgctaagctcagttggaaacaaaacatttgtgaaactgtaacccgaatgagggttactaccaccaaccaaaaccctcccatc |
531349 |
T |
 |
| Q |
110 |
acgaaccaaaacagcagtggaatgatacattcgaggtgtcttcgatgatctttgcaatttgaatctcgacccaattggattatttgttcggtaaagaaat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
531348 |
acgaaccaaaacagcagtggaatgatacattcgaggcgtctccgatgatctttgcaatttgaatctcgacccaattggattatttgttcggtaaagaaat |
531249 |
T |
 |
| Q |
210 |
ggggttagagccgggtcacgaccttgttcccatccagatgtccccgaagaagccccattaattatcaaaatgttaccatttggaagcatcaccatgtcac |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
531248 |
ggggttagagccgggtcacgaccttgttcccatccagatgtccccgaagaagccccattaattatcaaaatgttaccatttggaagcatcaccatgtcac |
531149 |
T |
 |
| Q |
310 |
tcatgactctaggcgatggcat |
331 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
531148 |
tcatgactctaggcgatggcat |
531127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 54; Significance: 6e-22; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 39 - 148
Target Start/End: Complemental strand, 7571260 - 7571151
Alignment:
| Q |
39 |
gttggaaacaaaacatttgtgaaattgtaacccgaatgagggttactaccaccaaccaaaaccctcccatcacgaaccaaaacagcagtggaatgataca |
138 |
Q |
| |
|
||||||||||| ||||| | ||||||||||| |||||||| ||||||||||| | |||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
7571260 |
gttggaaacaacacattgttaaaattgtaaccaatgtgagggttgctaccaccaacaagaaccctaccatcacgaaccaaaattgcagtggaatgataca |
7571161 |
T |
 |
| Q |
139 |
ttcgaggtgt |
148 |
Q |
| |
|
|||||||||| |
|
|
| T |
7571160 |
ttcgaggtgt |
7571151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University