View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1422_high_20 (Length: 319)
Name: NF1422_high_20
Description: NF1422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1422_high_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 97 - 302
Target Start/End: Complemental strand, 34771044 - 34770839
Alignment:
| Q |
97 |
ctaccaagtaatgatggggaagccaatgatcaacttcttaaatacataagttgttgcagtcgcatgtaacgaaggggccacaaccgtaacaattatgtaa |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34771044 |
ctaccaagtaatgatggggaagccaatgatcaacttcttaaatacataagttgttgcagtcgcctgtaacgaagggtccacaaccgtaacaattatgtaa |
34770945 |
T |
|
| Q |
197 |
attcatattttatgggttttcttttggcacttgatcaatcattgtgtagttgttacttactaggtgtctacttatgtatttgcacacaaattgtaataca |
296 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34770944 |
attcatattttatgggctttcttttggcacttgatcaatcattgtgtagttgttacttactaggtgtctacttatgtatttgcacacaaattgtaataca |
34770845 |
T |
|
| Q |
297 |
ttggct |
302 |
Q |
| |
|
|||||| |
|
|
| T |
34770844 |
ttggct |
34770839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 105 - 151
Target Start/End: Original strand, 8780692 - 8780738
Alignment:
| Q |
105 |
taatgatggggaagccaatgatcaacttcttaaatacataagttgtt |
151 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||| || |||||||||| |
|
|
| T |
8780692 |
taatgatgaggaaaccaatgatcaacttcttaattatataagttgtt |
8780738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University