View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1422_high_22 (Length: 316)
Name: NF1422_high_22
Description: NF1422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1422_high_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 306
Target Start/End: Original strand, 17196910 - 17197199
Alignment:
| Q |
1 |
tttttcggttgaatcgtcattgacttttctttagcttaacattgcagatcccagcactggatgttgaaacaagcttgacactaatgaataccaaatgttg |
100 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | |
|
|
| T |
17196910 |
tttttcggttgaattgtcattgatttttctttagcttaacattgcaaatcccagcactggatgttgaaacaagcttgacacta----------------g |
17196993 |
T |
 |
| Q |
101 |
taatctacttattttcttttgagtttatcattctttttctaatatacacagctctggggattatttatgcccaatctagaatttgattctctgcttgtta |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
17196994 |
taatctactttttttcttttgagtttatcattctttttctaatatacacagctctggggattatttatgctcaatctagaatttgattctctgcttgtta |
17197093 |
T |
 |
| Q |
201 |
atttgaatatttacttccttatttgacctagattaaacattgatgcactatagaaaaacattgcagaatttaatctccatgtgattattgatctatgtac |
300 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17197094 |
atttgaatatatacttccttatttgacctagattaaacattgatgcactatagaaaaacattgcagaatttaatctccatgtgattattgatctatgtac |
17197193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 17183492 - 17183381
Alignment:
| Q |
1 |
tttttcggttgaatcgtcattgacttttctttagcttaacattgcagatcccagcactggatgttgaaacaagcttgacactaatgaataccaaatgttg |
100 |
Q |
| |
|
||||||| ||||||| ||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
17183492 |
tttttcgattgaatcatcattgatttttctgtagcttaacattgcagatcccagcactggatgttgaaacaagcttgacactaatgaataccaaatgctc |
17183393 |
T |
 |
| Q |
101 |
taatctacttat |
112 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
17183392 |
taatctgcttat |
17183381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University