View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1422_high_28 (Length: 278)
Name: NF1422_high_28
Description: NF1422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1422_high_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 16 - 256
Target Start/End: Complemental strand, 45549861 - 45549621
Alignment:
| Q |
16 |
ctttgatctggatgggaaaagaggcaaatccaagaaataattatgttatttggaacggtggaggatgacatggcggtgggttggtggttcaaggtggtag |
115 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
45549861 |
ctttgatctggatgggaagagaggcaaatccaagaaataattatgttatttggaacggtggaggaagacatggcggtgggttggtggttcaaggtggtag |
45549762 |
T |
 |
| Q |
116 |
tgcaaattaggtagagaaaaacttaagtggagggtaacctaatgaaccgtgatgaatcattttgaaaattgctaaaaaatctgcacatgaccacaacaca |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45549761 |
tgcaaattaggtagagaaaaacttaagtggagggtaacctaatgaaccgtgatgaatcattttgaaaattgctaaaaaatctgcacatgaccacagcaca |
45549662 |
T |
 |
| Q |
216 |
ttctagtgttgagtggagggtaagctatctgaatagggttt |
256 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45549661 |
ttctagtgttgagtggaaggtaagctatctgaatagggttt |
45549621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University