View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1422_high_48 (Length: 235)
Name: NF1422_high_48
Description: NF1422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1422_high_48 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 129 - 218
Target Start/End: Original strand, 50632290 - 50632382
Alignment:
| Q |
129 |
cacacaagttgatgttttcttcattttctctttcaactagaattcaag---agtgtgtttgtttttgttgaatgaatgaatgaccaatgtttt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
50632290 |
cacacaagttgatgttttcttcattttctctttcaactacaattcaagagtagtgtgtttgtttttgtggaatgaatgaatgaccaatgtttt |
50632382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 13 - 69
Target Start/End: Original strand, 50632174 - 50632230
Alignment:
| Q |
13 |
cataggtcataaaagggtgtctgtttgcatatttggtccaccaaatcatccttcatt |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50632174 |
cataggtcataaaagggtgtctgtttgcatatttggtccaccaaatcatccttcatt |
50632230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University