View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1422_high_53 (Length: 224)
Name: NF1422_high_53
Description: NF1422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1422_high_53 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 98 - 208
Target Start/End: Original strand, 11669266 - 11669376
Alignment:
| Q |
98 |
tatgctttgtaaatttggttctcatattctttttaattgtacttgtgaattttgatccttggttatcaaagttttggaaacttatttggcttcaaaaagt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
11669266 |
tatgctttgtaaatttggttctcatattctttttaattgtacttgtgaattttgatccttggttatcaaagttttggaaacttatttggcttcaaaatat |
11669365 |
T |
|
| Q |
198 |
tgtcttgtggg |
208 |
Q |
| |
|
||||||||||| |
|
|
| T |
11669366 |
tgtcttgtggg |
11669376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University