View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1422_high_9 (Length: 420)
Name: NF1422_high_9
Description: NF1422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1422_high_9 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 400; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 400; E-Value: 0
Query Start/End: Original strand, 1 - 420
Target Start/End: Complemental strand, 31098730 - 31098311
Alignment:
| Q |
1 |
tatcaaaatttgttgagagacaacattcgagtgagaattttttaggagaaatgactgaaatgagcatgccaaagagaggatgagcaggtggttgcgaagg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31098730 |
tatcaaaatttgttgagagacaacattcgagtgagaattttttaggagaaatgactgaaatgagcatgccaaagagaggatgagcaggtggttgcaaagg |
31098631 |
T |
|
| Q |
101 |
cagtgggagattgtgaccaaggagggagtattttttgcatcttgatggaggtctgttgcaacaaggtaaagccacgagttttaagaaaatgagagctatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31098630 |
cagtgggagattgtgaccaaggagggagtaatatttgcatcttgatggaggtctgttgcaacgaggtaaagccacgagttttaagaaaatgagagctatg |
31098531 |
T |
|
| Q |
201 |
tactgcgagaagagaaagatgcgtttgtttgagatggcttattattgaagaagtcacgaccatgagatggtgttgggagaagaccgtctttgccgccgca |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31098530 |
tactgcgagaagagaaagatgcgtttgtttgagatggcttattattgaagaagtcacgaccatgagatggtgttgggagaagaccgtctttgccgccgca |
31098431 |
T |
|
| Q |
301 |
gcattgcaaaatttgcaaaaggaacttgtatatcagtttgtgtttaatgacgaaggtagtcatcatgagcaagtagatggctgtgaagctcctcaaaagc |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31098430 |
gcattgcaaaatttgcaaaaggaacttgtatatcagtttgtgtttaatgacgaaggtagtcatcgtgagcaagtagatggctgtgaagctcctcaaaagc |
31098331 |
T |
|
| Q |
401 |
aaaggggtgttgacatgtgc |
420 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
31098330 |
aaaggggtgttgacatgtgc |
31098311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 349 - 412
Target Start/End: Complemental strand, 1700908 - 1700845
Alignment:
| Q |
349 |
gacgaaggtagtcatcatgagcaagtagatggctgtgaagctcctcaaaagcaaaggggtgttg |
412 |
Q |
| |
|
|||| |||||||||||||| || || |||||||| |||||||||||||| | ||| |||||||| |
|
|
| T |
1700908 |
gacgcaggtagtcatcatgtgcgagaagatggctatgaagctcctcaaaggtaaaagggtgttg |
1700845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University