View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1422_low_17 (Length: 362)
Name: NF1422_low_17
Description: NF1422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1422_low_17 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 16 - 362
Target Start/End: Complemental strand, 19467483 - 19467137
Alignment:
| Q |
16 |
tttatcatttttcacaatagaggatgtggttggtgatcgtttatgggtgataatatgcggcataaaaatgtttctttaaaagtttcattttctacttggc |
115 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||| |||||| |
|
|
| T |
19467483 |
tttatcattttttacaatagaggatgtggttggtgatcgtttatgggtgataatatgcggcataaacatgtttctttaaaagtttggttttctgcttggc |
19467384 |
T |
 |
| Q |
116 |
acttatttcgtaaccttctatcaacaaaggacaatttactaagacatagtattattcaagcaaattttgttttgtgtgtaggtgggtgtggtatggagga |
215 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
19467383 |
acttatttcgtaaccttctaccaacaaaggacaatttactaagacatagtattattcaagcaaattttgttttgtgtgtaggtgagtgtggtatggagga |
19467284 |
T |
 |
| Q |
216 |
atcggctgatcatcttttcttgcgttgtaacttttttggtagtatgtggtattttatacgagattggctcagactttcttcagttgatccgggaacttta |
315 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
19467283 |
atcggctgatcatctttttttgcgttgtaactttttcggtagtatgtggtattttatatgagattggctcggactttcttcagttgatccgggaacttta |
19467184 |
T |
 |
| Q |
316 |
gcagaccattttgtgcaatttattcaatcccgtggttttcagggatc |
362 |
Q |
| |
|
||||| |||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
19467183 |
gcagatcattttatgcaatttattcaatcacgtggttttcagggatc |
19467137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 115 - 244
Target Start/End: Complemental strand, 18802657 - 18802528
Alignment:
| Q |
115 |
cacttatttcgtaaccttctatcaacaaaggacaatttactaagacatagtattattcaagcaaattttgttttgtgtgtaggtgggtgtggtatggagg |
214 |
Q |
| |
|
||||| |||| ||||| |||| |||||||||| |||||||||||| | |||||||||||||| ||| |||||||||||||||||| ||||| | |
|
|
| T |
18802657 |
cacttgtttcataaccctctaccaacaaaggataatttactaagatgtggtattattcaagcaggtttcacaacgtgtgtaggtgggtgtggcatggatg |
18802558 |
T |
 |
| Q |
215 |
aatcggctgatcatcttttcttgcgttgta |
244 |
Q |
| |
|
|||||||| ||||||||||||||| ||||| |
|
|
| T |
18802557 |
aatcggctaatcatcttttcttgcattgta |
18802528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University