View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1422_low_28 (Length: 290)
Name: NF1422_low_28
Description: NF1422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1422_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 28 - 255
Target Start/End: Complemental strand, 42100168 - 42099941
Alignment:
| Q |
28 |
taaataagcttgtaaattgtaatcacatatttgtacaatcattcataaggaaatttgaccacttttcgccgtagatttgggtcaaaattgttgtttcagg |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42100168 |
taaataagcttgtaaattgtaatcacatatttgtacaatcattcataaggaaatctgaccacttttcgccgtagatttgggtcaaaattgttgtttcagg |
42100069 |
T |
 |
| Q |
128 |
atcgtaaatcttgaatattattgtgtgaagttaattagaagcatctacaaagataagtagaaccaacacatttgggggaaaatggtgaattgtataaaga |
227 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42100068 |
atcgtaaatcttgaatataattgtgtgaagttaattagaagcatctacgaagataaatagaaccaacacatttgggggaaaatggtgaactgtataaaga |
42099969 |
T |
 |
| Q |
228 |
aaatgtaggttcgttttagaatattttg |
255 |
Q |
| |
|
||| ||||||||||||||||||||||| |
|
|
| T |
42099968 |
aaaactaggttcgttttagaatattttg |
42099941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University