View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1422_low_31 (Length: 280)
Name: NF1422_low_31
Description: NF1422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1422_low_31 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 27 - 280
Target Start/End: Complemental strand, 33836413 - 33836161
Alignment:
| Q |
27 |
attagggtgttgtatttttatttgtttaatctaatatctaccannnnnnncaacaacaaaaatgagggggagttgcacactcgaggatacgattgtaaat |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33836413 |
attagggtgttgtatttttatttgtttaatctaatatctaccatttttttcaacaacaaaaatgagggggagttgcacactcgaggatacgattgtaaat |
33836314 |
T |
 |
| Q |
127 |
taccttttgtatataataggcaggtctttctttgtctaattgcatgctttgaaatttcgcttcttaataagtaaatcaagagtttttggtgagtacaaat |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
33836313 |
taccttttgtatataataggcaggtctttctttgtctaattgcatgctatgaaatttcgcttcttaataagtaaatcaagagtttttggtgagtac-aat |
33836215 |
T |
 |
| Q |
227 |
ataaagtagaccaaatcttgtatttattgcatcataacacacctttgcttctcc |
280 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
33836214 |
ataaagtagaccaaatcttgtatttatagcatcataacacacctttgattctcc |
33836161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University