View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1422_low_42 (Length: 250)
Name: NF1422_low_42
Description: NF1422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1422_low_42 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 47 - 235
Target Start/End: Original strand, 39752266 - 39752456
Alignment:
| Q |
47 |
ttagttaaaaatttgcaagaactacgataaatgtagtttgattaaataaaatattaatagcataaattgaattacgtgcagtggaaccctcataacttta |
146 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39752266 |
ttagttaaaaatttgcaagaactaagataaatgtagtttgattaaataaa-tattaatagcataaattgaattacgtgcagtggaaccctcataatttta |
39752364 |
T |
 |
| Q |
147 |
tcctaggaggctcgttcttggtgttcatcctaacgactagatatgtggtgagtgtcattgttgaaccaccttt---attagctaggaattat |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| |||||||||||| |||||||||||||||| |
|
|
| T |
39752365 |
tcctaggaggctcgttcttggtgttcatcctaacgactagatttgtggtgagtgtgattgctgaaccacctttataattagctaggaattat |
39752456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University