View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1422_low_49 (Length: 240)
Name: NF1422_low_49
Description: NF1422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1422_low_49 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 36 - 141
Target Start/End: Complemental strand, 39752112 - 39752007
Alignment:
| Q |
36 |
aataaactagatggttaacataattcagatatgtagttaattatgctgactagataattaattaatattacaagttgctataactaattaactatcaact |
135 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39752112 |
aataaattagatggttaacataattcagatatgtagttaattatgctcactagataattaattaatattacaagttgctataactaattaactatcaact |
39752013 |
T |
|
| Q |
136 |
gaatgc |
141 |
Q |
| |
|
|||||| |
|
|
| T |
39752012 |
gaatgc |
39752007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 39752226 - 39752174
Alignment:
| Q |
1 |
ataaaggaaaattagatgcatgcaggttcatatgaaataaactagatggttaa |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39752226 |
ataaaggaaaattagatgcatgcaggttcatatgaaataaactagatggttaa |
39752174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 36 - 80
Target Start/End: Complemental strand, 3603806 - 3603762
Alignment:
| Q |
36 |
aataaactagatggttaacataattcagatatgtagttaattatg |
80 |
Q |
| |
|
|||||| ||||||||||||| |||| | ||||||||||||||||| |
|
|
| T |
3603806 |
aataaattagatggttaacacaatttaaatatgtagttaattatg |
3603762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University