View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1422_low_51 (Length: 237)
Name: NF1422_low_51
Description: NF1422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1422_low_51 |
 | |
|
| [»] chr2 (3 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 4e-90; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 18 - 237
Target Start/End: Original strand, 17781837 - 17782056
Alignment:
| Q |
18 |
tctctaaccatttgaaatgcattcatttgttgctctgcatacaccggccacgtagcaattggcgcaccataccacaaactctccaatatcgagttccaac |
117 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
17781837 |
tctctaaccatttgaaacgcgttcatttgttgctctgcatacaccggccacgtagcaattggcacaccataccacaaactctccaatatcgagttccaac |
17781936 |
T |
|
| Q |
118 |
cacaatgcgacacgaatccacccaccgccttatgggccaataccttggcttgtgggacccaaccacaaactatacccatccccgcagtccgttccaaaaa |
217 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| ||||||| ||||| |||||||||||||| ||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
17781937 |
cacaatgcgagacgaatccacccacggccttgtgggccagaaccttcgcttgtgggacccacccacaaactatacccatccccgcagcccgtgtcaaaaa |
17782036 |
T |
|
| Q |
218 |
cccgtccggtagaacattgt |
237 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
17782037 |
cccgtccggtagaacattgt |
17782056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 21 - 235
Target Start/End: Original strand, 20582185 - 20582399
Alignment:
| Q |
21 |
ctaaccatttgaaatgcattcatttgttgctctgcatacaccggccacgtagcaattggcgcaccataccacaaactctccaatatcgagttccaaccac |
120 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||| ||||||||||| ||||||||| ||||| ||||||||||||| || |||||||||||||||| |
|
|
| T |
20582185 |
ctaaccatctggaatgcattcatttgttgctctgcatagaccggccacgtggcaattggcacaccaaaccacaaactctctaaaatcgagttccaaccac |
20582284 |
T |
|
| Q |
121 |
aatgcgacacgaatccacccaccgccttatgggccaataccttggcttgtgggacccaaccacaaactatacccatccccgcagtccgttccaaaaaccc |
220 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||| ||||||||||||||||||||| ||||| ||||||||||| ||| ||||||| ||||||||||| |
|
|
| T |
20582285 |
aatgcgacacgaatccacccactgccttgtgggccagtaccttggcttgtgggacccatccacatactatacccattcccacagtccgctccaaaaaccc |
20582384 |
T |
|
| Q |
221 |
gtccggtagaacatt |
235 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
20582385 |
atccggtagaacatt |
20582399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 33 - 235
Target Start/End: Original strand, 20563034 - 20563236
Alignment:
| Q |
33 |
aatgcattcatttgttgctctgcatacaccggccacgtagcaattggcgcaccataccacaaactctccaatatcgagttccaaccacaatgcgacacga |
132 |
Q |
| |
|
|||||||||||||||||||| ||||| || |||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20563034 |
aatgcattcatttgttgctccgcataaactggccacgtggcaattggcacaccataccacaaactctccaatatcgagttccaaccacaatgcgacacga |
20563133 |
T |
|
| Q |
133 |
atccacccaccgccttatgggccaataccttggcttgtgggacccaaccacaaactatacccatccccgcagtccgttccaaaaacccgtccggtagaac |
232 |
Q |
| |
|
|||||||||| ||||||||||| | ||||| |||||||| | ||| ||||| || |||||||||||| || ||| |||||| || ||||||||||| |
|
|
| T |
20563134 |
atccacccactgccttatgggctagcacctttgcttgtggaatccacccacacacaatacccatccccatggttcgtctcaaaaatccatccggtagaac |
20563233 |
T |
|
| Q |
233 |
att |
235 |
Q |
| |
|
||| |
|
|
| T |
20563234 |
att |
20563236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University