View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1422_low_54 (Length: 235)
Name: NF1422_low_54
Description: NF1422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1422_low_54 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 14 - 235
Target Start/End: Complemental strand, 33836800 - 33836579
Alignment:
| Q |
14 |
cataaatcattcctcatcaaacaagtacatctttaaagggaaggctagcatgaaagcacaaataattaacggatcaattatatgactttgaaacacatat |
113 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33836800 |
cataaatcatttctcatcaaacaagtacatctttaaagggaaggctagcatgaaagcacaaataattaacggatcaattatatgactttaaaacacatat |
33836701 |
T |
 |
| Q |
114 |
agaccacttgttaacaacattgttaatagttcttggaaagggaaatgttgtagaagcattttcattctttaagcaactttgttgaagcataaattcaacc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33836700 |
agaccacttgttaacaacattgttaatagttcttggaaagggaaatgttgtagaagcattttcattctttaagcaactttgttgaagcataagttcaacc |
33836601 |
T |
 |
| Q |
214 |
atggtttgattttttagcacct |
235 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
33836600 |
atggtttgattttttagcacct |
33836579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University