View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1422_low_56 (Length: 226)
Name: NF1422_low_56
Description: NF1422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1422_low_56 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 648962 - 649186
Alignment:
| Q |
1 |
cgttgaacatgcttgttgtaacatgcctaatagaagtatttgaagctataatagcttaccttcattaaaaaatannnnnnnnnnnnngttgaacacgttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
648962 |
cgttgaacatgcttgttgtaacatgcctaatagaagtatttgaagctataatagcttaccttcattaaaaaatatttttttatttttgttgaacacgttt |
649061 |
T |
 |
| Q |
101 |
gttgtaacgtgctcaaataggataagcattttaagctagaggagcatacctgcataaatcatatcttggtgactggaagtatttcctttatctaaacttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
649062 |
gttgtaacgtgctcaaataggataagcattttaagctagaagagcatacctgcataaatcatatcttggtgactggaagtatttcctttatctaaacttc |
649161 |
T |
 |
| Q |
201 |
tagtaacacattgctgtttgtgatg |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
649162 |
tagtaacacattgctgtttgtgatg |
649186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 94 - 225
Target Start/End: Complemental strand, 239089 - 238958
Alignment:
| Q |
94 |
cacgtttgttgtaacgtgctcaaataggataagcattttaagctagaggagcatacctgcataaatcatatcttggtgactggaagtatttcctttatct |
193 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| ||||||||||| |||||| |||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
239089 |
cacgtttgttgtaacatgctcaaataggataagcaatttaagctagaagagcatccctgcataaatcatatcttggtaactggaaatatttcctttatct |
238990 |
T |
 |
| Q |
194 |
aaacttctagtaacacattgctgtttgtgatg |
225 |
Q |
| |
|
|||||| ||||||||||||| ||| ||||||| |
|
|
| T |
238989 |
aaacttatagtaacacattgttgtgtgtgatg |
238958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University