View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1422_low_60 (Length: 217)
Name: NF1422_low_60
Description: NF1422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1422_low_60 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 11 - 198
Target Start/End: Original strand, 51008900 - 51009087
Alignment:
| Q |
11 |
gtgagatgaacaatttcatcatgcaaaacattactgaaagattaagacctcttgttggtttgaatggctgggattactgtgtctactggaaattaagtga |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51008900 |
gtgacatgaacaatttcatcatgcaaaacattactgaaagattaagacctcttgttggtttgaatggctgggattactgtgtctactggaaattaagtga |
51008999 |
T |
 |
| Q |
111 |
agatcaaaggttataacttatatacataacattacattaattgtgatgctaatttgtcaaattaattgtgatgctaatttgttgattt |
198 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51009000 |
agatcaaaggttataacttatatacattacattacattaattgtgatgctaatttgtcaaattaattgtgatgctaatttgttgattt |
51009087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University