View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14230_low_7 (Length: 242)
Name: NF14230_low_7
Description: NF14230
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14230_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 94; Significance: 5e-46; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 124 - 221
Target Start/End: Complemental strand, 12252808 - 12252711
Alignment:
| Q |
124 |
agacaatatgatttatattcatgcacatcgattcctggtaaaccttgtaatgattatactgcagaaaagggtcataaaatgttgattgcttgtgaaga |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12252808 |
agacaatatgatttatattcatgcacatcgattcctggtaaaccttgtaatgattatactgcagaaaagggtcataaaatgttgattgcctgtgaaga |
12252711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 10 - 95
Target Start/End: Complemental strand, 12252922 - 12252837
Alignment:
| Q |
10 |
agaagcaaaggttgatggttttggaccaaattaatcaataagatggttggaatcaccaattaccaatatgcagcaactgcttctaa |
95 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
12252922 |
agaagaaaaggttgatggttttggaccaaattaatcaataagatggttggaatcaccaattacaaatactcagcaactgcttctaa |
12252837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 133 - 221
Target Start/End: Complemental strand, 12245186 - 12245098
Alignment:
| Q |
133 |
gatttatattcatgcacatcgattcctggtaaaccttgtaatgattatactgcagaaaagggtcataaaatgttgattgcttgtgaaga |
221 |
Q |
| |
|
||||||||||| |||||||||||| || |||||||||| ||||||||||| || | ||| ||||||||||||||||| ||| |||||| |
|
|
| T |
12245186 |
gatttatattcgtgcacatcgattactcgtaaaccttgaaatgattataccgcgaagaagtgtcataaaatgttgattccttatgaaga |
12245098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University