View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14231_high_25 (Length: 325)
Name: NF14231_high_25
Description: NF14231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14231_high_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 1 - 307
Target Start/End: Original strand, 9196024 - 9196330
Alignment:
| Q |
1 |
atgaacgaagcactcatgaaacttcttctgaaactcgattcaattccagggatcgatccaacggttagggaagcaaggagaaaggtgacacgtcggatcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
9196024 |
atgaacgaagcactcatgaaacttcttctgaaactcgattcaattccagggatcgatccaacggttagggaagcaaggagaaaggtgacacgtcggattg |
9196123 |
T |
 |
| Q |
101 |
tgggtttgcaggagatacttgattctgtttcggaagtgaaagttgatcaatggtgggagatgaataattggtatcaagttgttgaagaaatggaagaaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9196124 |
tgggtttgcaggagatacttgattctgtttcggaagtgaaagttgatcaatggtgggagatgaataattggtatcaagttgttgaagaaatggaagaaag |
9196223 |
T |
 |
| Q |
201 |
tgtttgtagagaaagaggtggtgatgaaatggaacagttttgtgcccagaatttgggatttcgttgcttacaaaggtttcttcatgaaccctgattcaca |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
9196224 |
tgtttgtagagaaagaggtggtgatgaaatggaacagttttgtgcccagaatttgggatttcgttgcttacaaaggtttcttcatgaaccctgatttaca |
9196323 |
T |
 |
| Q |
301 |
cttatag |
307 |
Q |
| |
|
||||||| |
|
|
| T |
9196324 |
cttatag |
9196330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University