View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14231_high_33 (Length: 245)
Name: NF14231_high_33
Description: NF14231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14231_high_33 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 25625393 - 25625163
Alignment:
| Q |
1 |
taaaaatgaaatatgtaaaatttatttatgatagggaggggctccatgcctagatttcatatagtgaaggaccttttcaaccacaacgatgttattgaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25625393 |
taaaaatgaaatatgtaaaatttatttatgatagggaggggctccatgtctagatttcatatagtgaaggaccttttcaaccacaacgatgttattgaga |
25625294 |
T |
|
| Q |
101 |
cttcgattgttagagaaaaactacttgtcatgaagtgtactgacaagaaattcaataactctactcattctttgtgccaaaagttttgtaacttcttgca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25625293 |
cttcgattgttagagaaaaactacttgtcacgaagtgtactgacaagaaattcaataactctactcattctttgtgccaaaagttttgtaacttcttgca |
25625194 |
T |
|
| Q |
201 |
agagacattccttatgggacaaggcttcttc |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
25625193 |
agagacattccttatgggacaaggcttcttc |
25625163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University