View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14231_high_37 (Length: 203)

Name: NF14231_high_37
Description: NF14231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14231_high_37
NF14231_high_37
[»] chr8 (1 HSPs)
chr8 (107-197)||(15264259-15264350)


Alignment Details
Target: chr8 (Bit Score: 59; Significance: 3e-25; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 107 - 197
Target Start/End: Complemental strand, 15264350 - 15264259
Alignment:
107 ttagtgtctctaacacatagggatgaaatcaaacaaaattcacannnnnnn-gtcaacttatatctagtataaattaaagtttatcttctgt 197  Q
    |||| |||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||||||    
15264350 ttagcgtctctaacacatagggatgaaatcaaacaaaattcacatttttttcgtcaacttatatctagtataaattaaagtttatcttctgt 15264259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University