View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14231_high_37 (Length: 203)
Name: NF14231_high_37
Description: NF14231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14231_high_37 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 59; Significance: 3e-25; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 107 - 197
Target Start/End: Complemental strand, 15264350 - 15264259
Alignment:
| Q |
107 |
ttagtgtctctaacacatagggatgaaatcaaacaaaattcacannnnnnn-gtcaacttatatctagtataaattaaagtttatcttctgt |
197 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15264350 |
ttagcgtctctaacacatagggatgaaatcaaacaaaattcacatttttttcgtcaacttatatctagtataaattaaagtttatcttctgt |
15264259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University