View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14231_high_9 (Length: 542)
Name: NF14231_high_9
Description: NF14231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14231_high_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 222 - 266
Target Start/End: Complemental strand, 2839946 - 2839902
Alignment:
| Q |
222 |
acccttctcaaccctaaccctactcaccacaacaccttccagcgt |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2839946 |
acccttctcaaccctaaccctactcaccacaacaccttccagcgt |
2839902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University