View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14231_low_26 (Length: 346)
Name: NF14231_low_26
Description: NF14231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14231_low_26 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 338; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 338; E-Value: 0
Query Start/End: Original strand, 1 - 346
Target Start/End: Complemental strand, 45654422 - 45654077
Alignment:
| Q |
1 |
agaacgccgatgacgatgtcgatgttgttgatcttgatccctctaaacatcgtcgcatccacctccacaaagagcaatggttcgttccttccctctttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45654422 |
agaacgccgatgacgatgtcgatgttgttgatcttgatccctctaaacatcgtcgcatccacctccacaaagagcaatggttcgttccttccctctttca |
45654323 |
T |
 |
| Q |
101 |
catattactattatgtcttaatccaatttaattaatgaaaatcgttttaattactgttaggtttgcagatgcatataattttctaatctgtttacctact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
45654322 |
catattactattatgtcttaatccaatttaattaatgaaaatcgttttaattactgttaggtttgcagatgcatataattttataatctgtttacctact |
45654223 |
T |
 |
| Q |
201 |
gaaaatcatatttggtgtggtttttgggatataatggctcctcttttggagactttttacaattactacaaagatgaccgccacgattcacctcttagac |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45654222 |
gaaaatcatatttggtgtggtttttgggatataatggctcctcttttggagactttttacaattactacaaagatgaccgccacgattcacctcttagac |
45654123 |
T |
 |
| Q |
301 |
ggttgtggaacagaatctctcatgaaatgaaccactgtcttcagtg |
346 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
45654122 |
ggttgtggaacagaatctctcatgaaatgaaccactgccttcagtg |
45654077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University