View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14231_low_30 (Length: 283)
Name: NF14231_low_30
Description: NF14231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14231_low_30 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 114 - 283
Target Start/End: Complemental strand, 49889091 - 49888922
Alignment:
| Q |
114 |
gagattaatgtggatggagcagaaaataatgtaaaaagaaagagcnnnnnnnnttccatggttgtgattgaagcaaaacaacataaggagcaaatagaaa |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49889091 |
gagattaatgtggatggagcagaaaataatgtaaaaagaaagagcaaaaaaaattcgatggttgtgattgaagcaaaacaacataaggagcaaatagaaa |
49888992 |
T |
 |
| Q |
214 |
atcttcagcacaaggttagaccaattacattgttgtttcttagtatactaagatacctgtgtatgcaact |
283 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49888991 |
atcttcagcacaaggttagacccattacattgttgtttcttagtatactaagatacctgtgtatgcaact |
49888922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University