View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14231_low_39 (Length: 244)
Name: NF14231_low_39
Description: NF14231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14231_low_39 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 14 - 222
Target Start/End: Complemental strand, 672766 - 672562
Alignment:
| Q |
14 |
ataatactagaaacaaagttgggatgtcctcaaacaataatgatacttctgcacttttagttttgctaaatatttcgtgcatttctcagatttaagatcc |
113 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
672766 |
ataatattagaaacaaagttgggatgtcctcaaaccataatgaaacttctgcacttttagttttgctaaatatttcgtgcatttctcagattcaagatcc |
672667 |
T |
 |
| Q |
114 |
taaatatgtgcaatattcnnnnnnnnnnnnnnnnatatagtaaaatttgtgcaatattcattatcgtacttcctagacgtaccatataaatattaaatac |
213 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
672666 |
taaatatgtgcaatattc----attattatttttatatagtaaaatttgtgcaatattcattatcgtacttcctagaagtaccatataaatattaaatac |
672571 |
T |
 |
| Q |
214 |
gctttggtt |
222 |
Q |
| |
|
||||||||| |
|
|
| T |
672570 |
gctttggtt |
672562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University