View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14231_low_44 (Length: 209)
Name: NF14231_low_44
Description: NF14231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14231_low_44 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 42455877 - 42455668
Alignment:
| Q |
1 |
ccaaacatgtcaaaatcaattctattgctccataatcaattttactcaaaagcaacaaaacatgtcaaaagctgcaaaagtaagtaatgtgcatc-aaaa |
99 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| |||| |
|
|
| T |
42455877 |
ccaaacatgtcaaaatcaattctactgctccataatcaattttactcaaaagcaacaaaacatgttaaaagctgcaaaagtaagtaatgtacatcaaaaa |
42455778 |
T |
|
| Q |
100 |
aatcttcggggcgtataaggtaaattatcccattccgattgannnnnnncatacgtaagagtaaaaaactgattttaccaagacatcaaaggtaatttat |
199 |
Q |
| |
|
||||| ||||||| |||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42455777 |
aatctatggggcgtttaaggtaaattatccccttccgattgatttttttcatacgtaagagtaaaaaactgattttaccaagacatcaaaggtaatttat |
42455678 |
T |
|
| Q |
200 |
gaaaacaaag |
209 |
Q |
| |
|
|||||||||| |
|
|
| T |
42455677 |
gaaaacaaag |
42455668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University