View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14232_high_10 (Length: 288)
Name: NF14232_high_10
Description: NF14232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14232_high_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 274
Target Start/End: Complemental strand, 49085637 - 49085363
Alignment:
| Q |
1 |
tcaccctgtacttggcgaacaaactgccctttcacccgggggcggttctctgcctgtctttttcggctttcatatcggacctgtaaaataaatttgacca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
49085637 |
tcaccctgtacttggcgaacaaactgccctttcacccgggggcggttctctgcctgtctttttcggctttcatatcggacctgtaaaataaatttgagca |
49085538 |
T |
|
| Q |
101 |
atgagcatctgaaatatctttaataatgtcagcctagacatgtttgagattactaaaa-cacacagtaggagtttccaaacttactaaaaacactaatac |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
49085537 |
atgagcatctgaaatatctttaataatgtcagcctagacatgtttgagattactaaaaccacacagtaggagtttccaaacttactaaaaacactgatac |
49085438 |
T |
|
| Q |
200 |
catattgataaatcaactcaaattgttccctatgataaaaatatttctagagtggttcttctcaaaagtagtgat |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49085437 |
catattgataaatcaactcaaattgttccctatgacaaaaatatttctagagtggttcttctcaaaagtagtgat |
49085363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University