View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14232_low_11 (Length: 294)
Name: NF14232_low_11
Description: NF14232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14232_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 18 - 277
Target Start/End: Original strand, 26249881 - 26250140
Alignment:
| Q |
18 |
agatagaatagaaaatgcaactactactacttccaacattgttttacaccaaaaaggaagagaaaattttgcacattattattatctagtggggcataga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26249881 |
agatagaatagaaaatgcaactactactacttccaacattgttttacaccaaaaaggaagagaaaattttgcacattattattatctagtggggcataga |
26249980 |
T |
|
| Q |
118 |
agcttcttaattgttggaacttggattgcttggaccaaggttaagagcagtgcttggaccattgccattctgagtgctgctaccaccctttgaaagcttc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26249981 |
agcttcttaattgttggaacttggattgcttggaccaaggttaagagcagtgcttggaccattgccattctgagtgctgctaccaccctttgaaagcttc |
26250080 |
T |
|
| Q |
218 |
tgtttcagctgagatagcagaacctgattctcctcattcagaagctttgctttcttccta |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26250081 |
tgtttcagctgagatagcagaacctgattctcctcattcagaagctttgctttcttccta |
26250140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University