View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14232_low_18 (Length: 252)
Name: NF14232_low_18
Description: NF14232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14232_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 4 - 246
Target Start/End: Original strand, 32591569 - 32591813
Alignment:
| Q |
4 |
atatttttaattgatgtggtttcaaagtttctaagaggtcacatactcnnnnnnn-ataagcaaataataattttactttttaatggaggg-tcctagaa |
101 |
Q |
| |
|
|||||| ||||||||||| | ||||||||||||||||||||||||||| ||||||||||||| |||||| |||||||||||||| |||||||| |
|
|
| T |
32591569 |
atatttctaattgatgtgatgtcaaagtttctaagaggtcacatactctcttttttataagcaaataattattttattttttaatggaggggtcctagaa |
32591668 |
T |
 |
| Q |
102 |
atttatcacattgtctagactctagactctccggcaagtgctattagagtcatcttttagcttggcggggaagcggtagtgagatactagtgtggatcaa |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32591669 |
atttatcacattgtctagactctagactctccgacaagtgttattagagtcatcttttagcttggcgggggagcggtagtgagatactagtgtggatcaa |
32591768 |
T |
 |
| Q |
202 |
gtctcgtgatgtgaatgattcacacttacgagagatattcttgga |
246 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32591769 |
gtctagtgatgtgaatgattcacacttacgagagatattattgga |
32591813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University