View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14232_low_21 (Length: 246)
Name: NF14232_low_21
Description: NF14232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14232_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 17 - 230
Target Start/End: Complemental strand, 6445181 - 6444968
Alignment:
| Q |
17 |
atatataggatggagggaaagtgtcaaaagacggtagttgattgcgactttcttttttgctactactttgatatcatcgcgtacccgaaaccgtttttgc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6445181 |
atatataggatggagggaaagtgtcaaaagacggtagttgattgcgactttattttttgctactactttgatatcatcgcgtacctgaaaccgtttttgc |
6445082 |
T |
|
| Q |
117 |
tgacgtggactcttggcaccaaacgtgctttcgatgcaagctagtattgctgtttctatgactagcagaacttctatggttacgctatgttctgttcttt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6445081 |
tgacgtggactcttggcaccaaacgtgctttcgatgcaagctagtattgctgtttctatgactagcagaacttctatggttacactatgttctgttcttt |
6444982 |
T |
|
| Q |
217 |
tgaacaccttgcca |
230 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
6444981 |
tgaacaccttgcca |
6444968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University