View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14232_low_23 (Length: 239)
Name: NF14232_low_23
Description: NF14232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14232_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 32591584 - 32591364
Alignment:
| Q |
1 |
catcaattaaaaatatgagaaatgttatatataagagaggtgagtcatatacccaattccttaagattttgggtatatatttgtggtgtcaatgtctctc |
100 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
32591584 |
catcaattagaaatataagaaatgttatatataagagaggtgagtcatatatccaattccttaaggttttgggtatatatttgtggtgtcgatgtctctc |
32591485 |
T |
|
| Q |
101 |
ttcaggatcctagatttttagatcgttattgctcaatatgcaccccaaactctcccaacaagtggtattagagatgtccttcagcttggcaggggagcaa |
200 |
Q |
| |
|
||| || |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32591484 |
ttcggggtcctagatttttagatcgttgttgctcaatatgcaccccaaactctcccaacaagtggtattagagatatccttcagcttggcaggggagcaa |
32591385 |
T |
|
| Q |
201 |
gagtgagatcttagtgatatg |
221 |
Q |
| |
|
|||||||||| || ||||||| |
|
|
| T |
32591384 |
gagtgagatcctaatgatatg |
32591364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 27 - 74
Target Start/End: Original strand, 23161956 - 23162003
Alignment:
| Q |
27 |
atatataagagaggtgagtcatatacccaattccttaagattttgggt |
74 |
Q |
| |
|
||||||||||||||||| |||||||||| || |||||||||||||||| |
|
|
| T |
23161956 |
atatataagagaggtgactcatatacccgatgccttaagattttgggt |
23162003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 27 - 75
Target Start/End: Original strand, 51681590 - 51681638
Alignment:
| Q |
27 |
atatataagagaggtgagtcatatacccaattccttaagattttgggta |
75 |
Q |
| |
|
|||||||||||||| || ||||||||||| | ||||||||||||||||| |
|
|
| T |
51681590 |
atatataagagaggggactcatatacccattgccttaagattttgggta |
51681638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University