View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14232_low_27 (Length: 205)
Name: NF14232_low_27
Description: NF14232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14232_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-100; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 48204569 - 48204370
Alignment:
| Q |
1 |
tttgtacaatcacgacattttcttgatcatgtgtgcttgcatctttcttttctcaaacacaatagttgtcttatatttgtgcattcaaaccaatttgagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48204569 |
tttgtacaatcacgacattttcttgatcatgtgtgcttgcatctttcttttctcaaacacaatagttgtcttatatttgtgcattcaaaccaatttgagc |
48204470 |
T |
 |
| Q |
101 |
tatccacttttttggtgttaacaataatatctatttgttgttatatatataaattcataaaagcaacacatagatcaacacagattaatttcttctctct |
200 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
48204469 |
tatccacttttttggtgttaacgataatatctatttgttgtcatatatataaattcataaaagcaacacatagatcaacatagattaatttcttttctct |
48204370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 77 - 139
Target Start/End: Original strand, 34498082 - 34498145
Alignment:
| Q |
77 |
ttgtgcattcaaaccaatttgagctatccacttttttg-gtgttaacaataatatctatttgtt |
139 |
Q |
| |
|
||||||||| |||| ||||| |||||||| ||||||| |||||||||||| |||||||||||| |
|
|
| T |
34498082 |
ttgtgcattgaaacaaattttagctatccgctttttttagtgttaacaatagtatctatttgtt |
34498145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University