View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14233_high_6 (Length: 279)
Name: NF14233_high_6
Description: NF14233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14233_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 15 - 261
Target Start/End: Original strand, 45817946 - 45818192
Alignment:
| Q |
15 |
tatagggtacaaaatatatattgttttaacttatagatttcctaaaatgcaaaaagagttaaacatgtgcatgttttgttagtttaataacacgaagatt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45817946 |
tatagggtacaaaatatatattgttttaacttatagatttcctaaaatgcaaaaagagttaaacatgtgcatgttttgttagtttaataacacgaagatt |
45818045 |
T |
 |
| Q |
115 |
aagtgcatttaaatgggatgataactatttctttcaatttaaccaaggtttgaattcaaaatttctttgtaaggataactttctcatttattatgatcat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45818046 |
aagtgcatttaaatgggatgataactatttctttcaatttaaccaaggtttgaattcaaaatttctttgtaaggataactttctcatttattatgatcat |
45818145 |
T |
 |
| Q |
215 |
attcaacgagattaatcactattgttgcatgaagagatactcaattt |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45818146 |
attcaacgagattaatcactattgttgcatgaagagatactcaattt |
45818192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University